ID: 1114736684_1114736692

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1114736684 1114736692
Species Human (GRCh38) Human (GRCh38)
Location 14:25049877-25049899 14:25049916-25049938
Sequence CCGTGCAGCCTGGCTCGCGCCCC GGCACGCGTCCCAGAGCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 233} {0: 1, 1: 0, 2: 1, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!