ID: 1114758018_1114758026

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1114758018 1114758026
Species Human (GRCh38) Human (GRCh38)
Location 14:25282192-25282214 14:25282220-25282242
Sequence CCAGCAAACACTGTATTTCCCTT CCTGTTGACTTAAAGGTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 19, 3: 226, 4: 538} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!