ID: 1114921774_1114921778

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1114921774 1114921778
Species Human (GRCh38) Human (GRCh38)
Location 14:27341807-27341829 14:27341826-27341848
Sequence CCCAAATCTCACCTTGAATTGTA TGTAATAATCCCCATGTGTTGGG
Strand - +
Off-target summary {0: 1257, 1: 8964, 2: 10159, 3: 8288, 4: 7147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!