ID: 1115006364_1115006366

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1115006364 1115006366
Species Human (GRCh38) Human (GRCh38)
Location 14:28490014-28490036 14:28490049-28490071
Sequence CCAAAGTGCTGAGACAGAAGTTG ATGTCCATCCAAAAGAATGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 49, 4: 937} {0: 1, 1: 2, 2: 2, 3: 29, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!