ID: 1115050586_1115050593

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1115050586 1115050593
Species Human (GRCh38) Human (GRCh38)
Location 14:29056958-29056980 14:29057010-29057032
Sequence CCAACAAAAAACAAAAAACAAAA ATAAGGTATCTAGAGAAGTTTGG
Strand - +
Off-target summary {0: 5, 1: 120, 2: 851, 3: 20822, 4: 41448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!