ID: 1115063249_1115063254

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1115063249 1115063254
Species Human (GRCh38) Human (GRCh38)
Location 14:29220680-29220702 14:29220704-29220726
Sequence CCGTGTATGAGTGAGACAGATGG CTGTCTGTGCATAGAGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!