ID: 1115075938_1115075942

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1115075938 1115075942
Species Human (GRCh38) Human (GRCh38)
Location 14:29390470-29390492 14:29390523-29390545
Sequence CCATTAAGGTAATTATATGGAAC ATGTTTGTCTAATTGGTGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!