ID: 1115085739_1115085745

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1115085739 1115085745
Species Human (GRCh38) Human (GRCh38)
Location 14:29512970-29512992 14:29512998-29513020
Sequence CCCTGTGGCTTTGCAGGGTACAG CTCCAGCTGCTTTCACAGGCTGG
Strand - +
Off-target summary {0: 877, 1: 1466, 2: 1338, 3: 996, 4: 796} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!