ID: 1115114834_1115114838

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1115114834 1115114838
Species Human (GRCh38) Human (GRCh38)
Location 14:29867674-29867696 14:29867698-29867720
Sequence CCATGGCTGTGCCATGAAGGAGT GTACAGAGGCAGAATGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 208} {0: 1, 1: 0, 2: 3, 3: 23, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!