ID: 1115143396_1115143399

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1115143396 1115143399
Species Human (GRCh38) Human (GRCh38)
Location 14:30199360-30199382 14:30199387-30199409
Sequence CCTGTTATCTTCTGGAGATAACT TTCTTTTGAGAGGCAACTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!