ID: 1115175668_1115175677

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1115175668 1115175677
Species Human (GRCh38) Human (GRCh38)
Location 14:30559106-30559128 14:30559152-30559174
Sequence CCCTCGAGGGCGGGGCCGACCGC GTGGACGAATTTGAATCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63} {0: 1, 1: 0, 2: 1, 3: 27, 4: 671}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!