|
Left Crispr |
Right Crispr |
| Crispr ID |
1115179413 |
1115179417 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:30605055-30605077
|
14:30605079-30605101
|
| Sequence |
CCCAGCTTATTTTGTATTTTCAG |
AGAGACAGGGTTTCTCCCTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 353, 2: 9351, 3: 22909, 4: 14812} |
{0: 1, 1: 45, 2: 405, 3: 1106, 4: 2417} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|