ID: 1115203021_1115203033

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1115203021 1115203033
Species Human (GRCh38) Human (GRCh38)
Location 14:30874269-30874291 14:30874306-30874328
Sequence CCGCTGCTGCCGCCGTCGGGGCC CTCGTTGAGACGCCGGCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 608} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!