ID: 1115203030_1115203036

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1115203030 1115203036
Species Human (GRCh38) Human (GRCh38)
Location 14:30874301-30874323 14:30874326-30874348
Sequence CCACACTCGTTGAGACGCCGGCA GGGACCTTCGTGCCCCTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!