ID: 1115203030_1115203038

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1115203030 1115203038
Species Human (GRCh38) Human (GRCh38)
Location 14:30874301-30874323 14:30874331-30874353
Sequence CCACACTCGTTGAGACGCCGGCA CTTCGTGCCCCTCTAGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!