ID: 1115214757_1115214764

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1115214757 1115214764
Species Human (GRCh38) Human (GRCh38)
Location 14:31003458-31003480 14:31003499-31003521
Sequence CCTAATGATATTTGGGTCATGGA TAGATTAATGCCTTCTATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 135} {0: 1, 1: 0, 2: 9, 3: 56, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!