ID: 1115269202_1115269205

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1115269202 1115269205
Species Human (GRCh38) Human (GRCh38)
Location 14:31533006-31533028 14:31533029-31533051
Sequence CCCTCATTGGGTGCATGATTTGC AGAATTTCTCCCCATCCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 326} {0: 1, 1: 0, 2: 1, 3: 50, 4: 861}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!