ID: 1115279672_1115279676

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1115279672 1115279676
Species Human (GRCh38) Human (GRCh38)
Location 14:31647559-31647581 14:31647591-31647613
Sequence CCTGTGTAACACACCTCCTACAA GCTGAACAGTCAGTCTGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 169} {0: 2, 1: 7, 2: 35, 3: 81, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!