ID: 1115318043_1115318046

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1115318043 1115318046
Species Human (GRCh38) Human (GRCh38)
Location 14:32046900-32046922 14:32046941-32046963
Sequence CCTTTCAGGCTCACAGAACTGTT CAGAAAAATGTGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!