ID: 1115327240_1115327248

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1115327240 1115327248
Species Human (GRCh38) Human (GRCh38)
Location 14:32153764-32153786 14:32153815-32153837
Sequence CCTGCTGCAACCAGGTTTTCTGA GGCTCAACACTTTGGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 190} {0: 1, 1: 1, 2: 1, 3: 19, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!