ID: 1115344135_1115344141

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1115344135 1115344141
Species Human (GRCh38) Human (GRCh38)
Location 14:32324130-32324152 14:32324149-32324171
Sequence CCAAGTTCTAACCAGTGGAATGT ATGTGGGGTGGAAGTGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 32, 4: 166} {0: 1, 1: 0, 2: 4, 3: 54, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!