ID: 1115346577_1115346585

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1115346577 1115346585
Species Human (GRCh38) Human (GRCh38)
Location 14:32348973-32348995 14:32349020-32349042
Sequence CCCTCTAACCAGACAGAGTGCTT CCCTCTAGGACCTTTGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110} {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!