ID: 1115359874_1115359887

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1115359874 1115359887
Species Human (GRCh38) Human (GRCh38)
Location 14:32488727-32488749 14:32488777-32488799
Sequence CCAGATAGCACGGTCCTTCACTC CCCCTTGTGCTTCCCAGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 107} {0: 283, 1: 1371, 2: 1968, 3: 2195, 4: 1915}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!