|
Left Crispr |
Right Crispr |
| Crispr ID |
1115361552 |
1115361556 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:32509054-32509076
|
14:32509075-32509097
|
| Sequence |
CCTTGTGATCCTGCCTTGGCCTC |
TCCCAAAGTGCTGAGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 6, 2: 14, 3: 68, 4: 544} |
{0: 16720, 1: 305812, 2: 257224, 3: 144363, 4: 132215} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|