ID: 1115369107_1115369109

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1115369107 1115369109
Species Human (GRCh38) Human (GRCh38)
Location 14:32592178-32592200 14:32592191-32592213
Sequence CCCTGAACATTTGCTAGTTATGT CTAGTTATGTGCTGTGTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 192} {0: 1, 1: 0, 2: 1, 3: 18, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!