ID: 1115385276_1115385285

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1115385276 1115385285
Species Human (GRCh38) Human (GRCh38)
Location 14:32789447-32789469 14:32789478-32789500
Sequence CCAGCCACCTTCTACAGGTGTGG GCAACAGGTCAGTACCCTACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 28, 3: 82, 4: 290} {0: 1, 1: 4, 2: 31, 3: 54, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!