ID: 1115396843_1115396846

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1115396843 1115396846
Species Human (GRCh38) Human (GRCh38)
Location 14:32918423-32918445 14:32918463-32918485
Sequence CCTGAGCTTCAGAGATGATGAGA ACTAATAATCGAGCACCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!