ID: 1115408680_1115408688

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1115408680 1115408688
Species Human (GRCh38) Human (GRCh38)
Location 14:33048328-33048350 14:33048368-33048390
Sequence CCTCCTAGAGGATCAGCATTGTA GTGTAGCCCTTAAGGACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 2, 3: 6, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!