ID: 1115418449_1115418453

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1115418449 1115418453
Species Human (GRCh38) Human (GRCh38)
Location 14:33164855-33164877 14:33164874-33164896
Sequence CCTGTCAATTCACTGACTTCCTT CCTTCTGTACTGGTGAGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 251} {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!