ID: 1115469563_1115469569

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1115469563 1115469569
Species Human (GRCh38) Human (GRCh38)
Location 14:33754603-33754625 14:33754619-33754641
Sequence CCTCATCCCCATCCCACTGAATT CTGAATTTCCAGAAAGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 469} {0: 1, 1: 0, 2: 0, 3: 32, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!