ID: 1115474428_1115474440

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1115474428 1115474440
Species Human (GRCh38) Human (GRCh38)
Location 14:33800146-33800168 14:33800179-33800201
Sequence CCGCCGGCGCCTGTCCAGCGCGT CGGCCTGGACGCGGGCCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 1, 1: 0, 2: 1, 3: 17, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!