ID: 1115501468_1115501473

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1115501468 1115501473
Species Human (GRCh38) Human (GRCh38)
Location 14:34053697-34053719 14:34053725-34053747
Sequence CCACTAACTTTAGGAGCAGTCCT TGGGATTCCCAGTCAAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 77} {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!