ID: 1115502223_1115502229

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1115502223 1115502229
Species Human (GRCh38) Human (GRCh38)
Location 14:34060158-34060180 14:34060201-34060223
Sequence CCAGGGCGCGCCGCGGCGGACAC TGCGCCCGCGGCCGCCCCGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 102} {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!