ID: 1115502228_1115502244

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1115502228 1115502244
Species Human (GRCh38) Human (GRCh38)
Location 14:34060199-34060221 14:34060233-34060255
Sequence CCTGCGCCCGCGGCCGCCCCGAA ACTGCGGCGGGCGGCGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 303} {0: 1, 1: 0, 2: 6, 3: 45, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!