ID: 1115503325_1115503327

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1115503325 1115503327
Species Human (GRCh38) Human (GRCh38)
Location 14:34068520-34068542 14:34068537-34068559
Sequence CCCACTTTCTTATTCATAAACAA AAACAACTGTCTTTTTGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 545} {0: 1, 1: 0, 2: 2, 3: 37, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!