ID: 1115517186_1115517188

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1115517186 1115517188
Species Human (GRCh38) Human (GRCh38)
Location 14:34197640-34197662 14:34197665-34197687
Sequence CCAGGAAACTTCAAATAGGACAC AGAAACACAATTAAATGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 141} {0: 1, 1: 0, 2: 4, 3: 23, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!