ID: 1115522729_1115522733

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1115522729 1115522733
Species Human (GRCh38) Human (GRCh38)
Location 14:34248988-34249010 14:34249029-34249051
Sequence CCAGCTCATTCATTCATTCATTT ACTTTTTAGGGCCTTCCTTAGGG
Strand - +
Off-target summary {0: 2, 1: 17, 2: 115, 3: 688, 4: 9336} {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!