ID: 1115529365_1115529371

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1115529365 1115529371
Species Human (GRCh38) Human (GRCh38)
Location 14:34312808-34312830 14:34312844-34312866
Sequence CCCTTCTCCTTCTCCTTCTTCTT TGGGTTTCACCATGTTGCCCAGG
Strand - +
Off-target summary {0: 18, 1: 73, 2: 370, 3: 1367, 4: 5643} {0: 277, 1: 11529, 2: 125439, 3: 203811, 4: 234802}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!