ID: 1115529365_1115529372

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1115529365 1115529372
Species Human (GRCh38) Human (GRCh38)
Location 14:34312808-34312830 14:34312848-34312870
Sequence CCCTTCTCCTTCTCCTTCTTCTT TTTCACCATGTTGCCCAGGCTGG
Strand - +
Off-target summary {0: 18, 1: 73, 2: 370, 3: 1367, 4: 5643} {0: 9194, 1: 113135, 2: 189235, 3: 228006, 4: 255846}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!