|
Left Crispr |
Right Crispr |
| Crispr ID |
1115544881 |
1115544886 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:34456754-34456776
|
14:34456776-34456798
|
| Sequence |
CCGGGCGTGGTGGCACACACCTG |
GTAGTCCCAGCTACTCGGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1003, 1: 11586, 2: 54198, 3: 150376, 4: 228874} |
{0: 422, 1: 2132, 2: 4543, 3: 4500, 4: 3857} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|