ID: 1115545455_1115545467

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1115545455 1115545467
Species Human (GRCh38) Human (GRCh38)
Location 14:34462026-34462048 14:34462059-34462081
Sequence CCTGGGGAAATGCGGCCCCGCGG CAGCCCGGCCCCCGCGCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 67} {0: 1, 1: 1, 2: 3, 3: 22, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!