ID: 1115545545_1115545565

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1115545545 1115545565
Species Human (GRCh38) Human (GRCh38)
Location 14:34462348-34462370 14:34462390-34462412
Sequence CCCAGACCCGCGCGCGCCCCGGC CCGACCCGCGCTCATTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 290} {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!