ID: 1115549026_1115549033

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1115549026 1115549033
Species Human (GRCh38) Human (GRCh38)
Location 14:34488520-34488542 14:34488544-34488566
Sequence CCTCGCCTTTTCTAAAAATACAA AATTGGCTTGGCGTGGTGGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 174, 2: 12150, 3: 58138, 4: 94942}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!