ID: 1115555091_1115555103

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1115555091 1115555103
Species Human (GRCh38) Human (GRCh38)
Location 14:34539379-34539401 14:34539414-34539436
Sequence CCCCCCGGGACTGCGCGACCCCA TTTGGCTTCGCACAAGTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85} {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!