ID: 1115555099_1115555109

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1115555099 1115555109
Species Human (GRCh38) Human (GRCh38)
Location 14:34539398-34539420 14:34539450-34539472
Sequence CCCATCAGGAAAGCCCTTTGGCT CGAGCCGCTAGGGTCTGCGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 165} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!