ID: 1115581023_1115581026

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1115581023 1115581026
Species Human (GRCh38) Human (GRCh38)
Location 14:34758548-34758570 14:34758601-34758623
Sequence CCAGCCTGGGCGACAGAGTGAGA AAAACTAGACAGTGAGTAACAGG
Strand - +
Off-target summary {0: 15310, 1: 100461, 2: 170004, 3: 197206, 4: 179472} {0: 1, 1: 0, 2: 2, 3: 15, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!