ID: 1115611477_1115611484

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1115611477 1115611484
Species Human (GRCh38) Human (GRCh38)
Location 14:35052494-35052516 14:35052522-35052544
Sequence CCCGCGCCTGGCCCAACTTCAGG TTATTAGGAGTTTAAACTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 212} {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!