ID: 1115613398_1115613402

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1115613398 1115613402
Species Human (GRCh38) Human (GRCh38)
Location 14:35070312-35070334 14:35070353-35070375
Sequence CCGTGTCCGGCCTATAACAATAT GGAGTCTCGCTCTGTCGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 357} {0: 389, 1: 22411, 2: 62960, 3: 120758, 4: 147583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!