|
Left Crispr |
Right Crispr |
| Crispr ID |
1115613398 |
1115613403 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:35070312-35070334
|
14:35070357-35070379
|
| Sequence |
CCGTGTCCGGCCTATAACAATAT |
TCTCGCTCTGTCGTCCAGGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 1, 3: 32, 4: 357} |
{0: 626, 1: 30513, 2: 100498, 3: 203374, 4: 199364} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|