|
Left Crispr |
Right Crispr |
| Crispr ID |
1115618016 |
1115618022 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:35114867-35114889
|
14:35114880-35114902
|
| Sequence |
CCTATAATCCCAGCTACTTAGGA |
CTACTTAGGAGGGCTGAGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 250, 1: 12716, 2: 130747, 3: 254343, 4: 290879} |
{0: 1, 1: 68, 2: 512, 3: 1557, 4: 9417} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|